Lab Reagents
Human Elisa Laboratories manufactures the human met ecd protein elisa reagents distributed by Genprice. The Human Met Ecd Protein Elisa reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Human elisa. Other Human products are available in stock. Specificity: Human Category: Met Group: Ecd Protein
Ecd Protein information
ECD Recombinant Protein (Mouse) |
RP130709 |
ABM |
100 ug |
Ask for price |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human ECD shRNA Plasmid |
20-abx957749 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human HER-2 ECD ELISA Kit |
EHE0035 |
Abclonal |
96Tests |
EUR 521 |
ECD Conjugated Antibody |
C47313 |
SAB |
100ul |
EUR 397 |
ECD cloning plasmid |
CSB-CL007370HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1935
- Sequence: atggaagaaaccatgaagcttgctacgatggaagacacagtggagtactgcctgttcctgataccagatgagtcaagggactcagataaacataaagagattcttcagaagtacattgagagaataatcactcggtttgcacctatgctggtcccctacatctggcagaatcagc
- Show more
|
Description: A cloning plasmid for the ECD gene. |
anti- ECD antibody |
FNab02619 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: ecdysoneless homolog(Drosophila)
- Uniprot ID: O95905
- Gene ID: 11319
- Research Area: Metabolism
|
Description: Antibody raised against ECD |
ECD Polyclonal Antibody |
A58886 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
ECD Blocking Peptide |
DF12968-BP |
Affbiotech |
1mg |
EUR 195 |
ECD ORF Vector (Human) (pORF) |
ORF003373 |
ABM |
1.0 ug DNA |
EUR 95 |
Human Adiponectin ELISA Kit |
MET-5052 |
Cell Biolabs |
96 assays |
EUR 572 |
Human Insulin ELISA Kit |
MET-5063 |
Cell Biolabs |
96 assays |
EUR 572 |
ECD Protein Vector (Human) (pPB-C-His) |
PV013489 |
ABM |
500 ng |
EUR 329 |
ECD Protein Vector (Human) (pPB-N-His) |
PV013490 |
ABM |
500 ng |
EUR 329 |
ECD Protein Vector (Human) (pPM-C-HA) |
PV013491 |
ABM |
500 ng |
EUR 329 |