July 25, 2021

Human Met Ecd Protein Elisa

Lab Reagents

Human Elisa Laboratories manufactures the human met ecd protein elisa reagents distributed by Genprice. The Human Met Ecd Protein Elisa reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Human elisa. Other Human products are available in stock. Specificity: Human Category: Met Group: Ecd Protein

Ecd Protein information

ECD Recombinant Protein (Mouse)

RP130709 100 ug Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human ECD shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EHE0035 96Tests
EUR 521

ECD Blocking Peptide

DF12968-BP 1mg
EUR 195

ECD Conjugated Antibody

C47313 100ul
EUR 397

ECD cloning plasmid

CSB-CL007370HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1935
  • Sequence: atggaagaaaccatgaagcttgctacgatggaagacacagtggagtactgcctgttcctgataccagatgagtcaagggactcagataaacataaagagattcttcagaagtacattgagagaataatcactcggtttgcacctatgctggtcccctacatctggcagaatcagc
  • Show more
Description: A cloning plasmid for the ECD gene.

ECD Polyclonal Antibody

A58886 100 µg
EUR 570.55
Description: Ask the seller for details

anti- ECD antibody

FNab02619 100µg
EUR 548.75
  • Immunogen: ecdysoneless homolog(Drosophila)
  • Uniprot ID: O95905
  • Gene ID: 11319
  • Research Area: Metabolism
Description: Antibody raised against ECD

Anti-ECD antibody

PAab02619 100 ug
EUR 386

Mouse Protein SGT1 homolog, Ecd ELISA KIT

ELI-52962m 96 Tests
EUR 865

ECD ORF Vector (Human) (pORF)

ORF003373 1.0 ug DNA
EUR 95

Human Adiponectin ELISA Kit

MET-5052 96 assays
EUR 572

Human Insulin ELISA Kit

MET-5063 96 assays
EUR 572

ECD Protein Vector (Human) (pPB-C-His)

PV013489 500 ng
EUR 329

ECD Protein Vector (Human) (pPB-N-His)

PV013490 500 ng
EUR 329

ECD Protein Vector (Human) (pPM-C-HA)

PV013491 500 ng
EUR 329