October 28, 2021

Lsbio Dnajb9 Elisa

Lab Reagents

Human IgG antibody Laboratories manufactures the lsbio dnajb9 elisa reagents distributed by Genprice. The Lsbio Dnajb9 Elisa reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact lsbio elisa. Other Lsbio products are available in stock. Specificity: Lsbio Category: Dnajb9 Group: Elisa

Elisa information

DNAJB9 Conjugated Antibody
C42984 100ul
EUR 397

DNAJB9 cloning plasmid
CSB-CL866205HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 672
  • Sequence: atggctactccccagtcaattttcatctttgcaatctgcattttaatgataacagaattaattctggcctcaaaaagctactatgatatcttaggtgtgccaaaatcggcatcagagcgccaaatcaagaaggcctttcacaagttggccatgaagtaccaccctgacaaaaataa
  • Show more
Description: A cloning plasmid for the DNAJB9 gene.

DNAJB9 Rabbit pAb
A7494-100ul 100 ul
EUR 308

DNAJB9 Rabbit pAb
A7494-200ul 200 ul
EUR 459

DNAJB9 Rabbit pAb
A7494-20ul 20 ul
EUR 183

DNAJB9 Rabbit pAb
A7494-50ul 50 ul
EUR 223

anti- DNAJB9 antibody
FNab02455 100µg
EUR 505.25
  • Immunogen: DnaJ(Hsp40) homolog, subfamily B, member 9
  • Uniprot ID: Q9UBS3
  • Gene ID: 4189
  • Research Area: Metabolism
Description: Antibody raised against DNAJB9

Anti-DNAJB9 antibody
PAab02455 100 ug
EUR 355

Anti-DNAJB9 antibody
STJ29630 100 µl
EUR 277
Description: This gene is a member of the J protein family. J proteins function in many cellular processes by regulating the ATPase activity of 70 kDa heat shock proteins. This gene is a member of the type 2 subgroup of DnaJ proteins. The encoded protein is localized to the endoplasmic reticulum. This protein is induced by endoplasmic reticulum stress and plays a role in protecting stressed cells from apoptosis.

Mouse DNAJB9 shRNA Plasmid
20-abx973873
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat DNAJB9 shRNA Plasmid
20-abx984701
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DNAJB9 shRNA Plasmid
20-abx952849
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DNAJB9 Recombinant Protein (Human)
RP009556 100 ug Ask for price

DNAJB9 Recombinant Protein (Rat)
RP198323 100 ug Ask for price

DNAJB9 Recombinant Protein (Mouse)
RP129524 100 ug Ask for price

Anti-MDG1 / DNAJB9 antibody
STJ70514 100 µg
EUR 359

Polyclonal DNAJB9 Antibody (N-term)
APR15771G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DNAJB9 (N-term). This antibody is tested and proven to work in the following applications: