Lab Reagents
Human IgG antibody Laboratories manufactures the lsbio dnajb9 elisa reagents distributed by Genprice. The Lsbio Dnajb9 Elisa reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact lsbio elisa. Other Lsbio products are available in stock. Specificity: Lsbio Category: Dnajb9 Group: Elisa
Elisa information
anti- DNAJB9 antibody |
FNab02455 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: DnaJ(Hsp40) homolog, subfamily B, member 9
- Uniprot ID: Q9UBS3
- Gene ID: 4189
- Research Area: Metabolism
|
Description: Antibody raised against DNAJB9 |
DNAJB9 Rabbit pAb |
A7494-100ul |
Abclonal |
100 ul |
EUR 308 |
DNAJB9 Rabbit pAb |
A7494-200ul |
Abclonal |
200 ul |
EUR 459 |
DNAJB9 Rabbit pAb |
A7494-20ul |
Abclonal |
20 ul |
EUR 183 |
DNAJB9 Rabbit pAb |
A7494-50ul |
Abclonal |
50 ul |
EUR 223 |
DNAJB9 Blocking Peptide |
33R-5786 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DNAJB9 antibody, catalog no. 70R-7401 |
DNAJB9 cloning plasmid |
CSB-CL866205HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 672
- Sequence: atggctactccccagtcaattttcatctttgcaatctgcattttaatgataacagaattaattctggcctcaaaaagctactatgatatcttaggtgtgccaaaatcggcatcagagcgccaaatcaagaaggcctttcacaagttggccatgaagtaccaccctgacaaaaataa
- Show more
|
Description: A cloning plasmid for the DNAJB9 gene. |
Anti-DNAJB9 antibody |
STJ29630 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the J protein family. J proteins function in many cellular processes by regulating the ATPase activity of 70 kDa heat shock proteins. This gene is a member of the type 2 subgroup of DnaJ proteins. The encoded protein is localized to the endoplasmic reticulum. This protein is induced by endoplasmic reticulum stress and plays a role in protecting stressed cells from apoptosis. |
Mouse DNAJB9 shRNA Plasmid |
20-abx973873 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat DNAJB9 shRNA Plasmid |
20-abx984701 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human DNAJB9 shRNA Plasmid |
20-abx952849 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DNAJB9 Recombinant Protein (Human) |
RP009556 |
ABM |
100 ug |
Ask for price |
DNAJB9 Recombinant Protein (Rat) |
RP198323 |
ABM |
100 ug |
Ask for price |
DNAJB9 Recombinant Protein (Mouse) |
RP129524 |
ABM |
100 ug |
Ask for price |
Polyclonal DNAJB9 Antibody (N-term) |
APR15771G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DNAJB9 (N-term). This antibody is tested and proven to work in the following applications: |