January 19, 2021

Was Kostet Ein Elisa Serum Test

Lab Reagents

Human IgG antibody Laboratories manufactures the was kostet ein elisa serum test reagents distributed by Genprice. The Was Kostet Ein Elisa Serum Test reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact serum elisa. Other Was products are available in stock. Specificity: Was Category: Kostet Group: Ein Elisa

Ein Elisa information

WAS Antibody

1-CSB-PA025967LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WAS. Recognizes WAS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200

WAS siRNA

20-abx939644
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

WAS siRNA

20-abx939645
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

WAS Antibody

ABD6160 100 ug
EUR 438

Bovine BSA(serum albumin) ELISA Kit

EB0148 96T
EUR 567.6
  • Detection range: 0.156-10 ug/ml
Description: Method of detection: Competitive ELISA, Coated with antibody;Reacts with: Cattle ;Sensitivity: 0.094 ug/ml

TruStrip RDT Dog Serum Albumin Rapid Test cards, 10/pk

7000-RDT-10 1 Pk
EUR 171

TruStrip RDT Dog Serum Albumin Rapid Test cards, 25/pk

7000-RDT-25 1 Pk
EUR 293

WAS ELISA Kit (Human) (OKEH05298)

OKEH05298 96 Wells
EUR 662
Description: Description of target: Effector protein for Rho-type GTPases. Regulates actin filament reorganization via its interaction with the Arp2/3 complex. Important for efficient actin polymerization. Possible regulator of lymphocyte and platelet function. Mediates actin filament reorganization and the formation of actin pedestals upon infection by pathogenic bacteria.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.9 pg/mL

Recombinant human WAS/WASL-interacting protein family member 2

P2593 100ug Ask for price
  • Uniprot ID: Q8TF74
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human WAS/WASL-interacting protein family member 2

WAS Rabbit pAb

A0978-100ul 100 ul
EUR 308

WAS Rabbit pAb

A0978-200ul 200 ul
EUR 459

WAS Rabbit pAb

A0978-20ul 20 ul
EUR 183

WAS Rabbit pAb

A0978-50ul 50 ul
EUR 223

WAS Blocking Peptide

DF6160-BP 1mg
EUR 195

WAS Conjugated Antibody

C32105 100ul
EUR 397

WAS cloning plasmid

CSB-CL025967HU-10ug 10ug
EUR 532
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1509
  • Sequence: atgagtgggggcccaatgggaggaaggcccgggggccgaggagcaccagcggttcagcagaacataccctccaccctcctccaggaccacgagaaccagcgactctttgagatgcttggacgaaaatgcttgacgctggccactgcagttgttcagctgtacctggcgctgcccc
  • Show more
Description: A cloning plasmid for the WAS gene.

Anti-WAS antibody

STJ26106 100 µl
EUR 277
Description: The Wiskott-Aldrich syndrome (WAS) family of proteins share similar domain structure, and are involved in transduction of signals from receptors on the cell surface to the actin cytoskeleton. The presence of a number of different motifs suggests that they are regulated by a number of different stimuli, and interact with multiple proteins. Recent studies have demonstrated that these proteins, directly or indirectly, associate with the small GTPase, Cdc42, known to regulate formation of actin filaments, and the cytoskeletal organizing complex, Arp2/3. Wiskott-Aldrich syndrome is a rare, inherited, X-linked, recessive disease characterized by immune dysregulation and microthrombocytopenia, and is caused by mutations in the WAS gene. The WAS gene product is a cytoplasmic protein, expressed exclusively in hematopoietic cells, which show signalling and cytoskeletal abnormalities in WAS patients. A transcript variant arising as a result of alternative promoter usage, and containing a different 5' UTR sequence, has been described, however, its full-length nature is not known.