April 20, 2021

Spike Protein Ecd

Lab Reagents

Human IgG antibody Laboratories manufactures the spike protein ecd reagents distributed by Genprice. The Spike Protein Ecd reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Spike ECD. Other Spike products are available in stock. Specificity: Spike Category: Protein Group: Ecd

Ecd information

ECD Antibody

47313-100ul 100ul
EUR 252

ECD antibody

70R-16985 50 ul
EUR 435
Description: Rabbit polyclonal ECD antibody

ECD Antibody

DF12968 200ul
EUR 304
Description: ECD Antibody detects endogenous levels of ECD.

ECD Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ECD. Recognizes ECD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ECD Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ECD. Recognizes ECD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000


YF-PA27502 50 ug
EUR 363
Description: Mouse polyclonal to ECD

ECD Recombinant Protein (Human)

RP010117 100 ug Ask for price

ECD Recombinant Protein (Mouse)

RP130709 100 ug Ask for price

Recombinant (Sf9) Purified MERS Spike protein ECD (1-1297 a.a, His-tag, ~157 kda, low Endotoxin)

MERSS126-R-10 10 ug
EUR 347

ECD Conjugated Antibody

C47313 100ul
EUR 397

ECD cloning plasmid

CSB-CL007370HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1935
  • Sequence: atggaagaaaccatgaagcttgctacgatggaagacacagtggagtactgcctgttcctgataccagatgagtcaagggactcagataaacataaagagattcttcagaagtacattgagagaataatcactcggtttgcacctatgctggtcccctacatctggcagaatcagc
  • Show more
Description: A cloning plasmid for the ECD gene.

anti- ECD antibody

FNab02619 100µg
EUR 548.75
  • Immunogen: ecdysoneless homolog(Drosophila)
  • Uniprot ID: O95905
  • Gene ID: 11319
  • Research Area: Metabolism
Description: Antibody raised against ECD

ECD Polyclonal Antibody

A58886 100 µg
EUR 570.55
Description: Ask the seller for details

ECD Blocking Peptide

DF12968-BP 1mg
EUR 195

Anti-ECD antibody

PAab02619 100 ug
EUR 386

SARS-CoV Spike Protein

abx060655-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS Spike Antibody

  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.