October 20, 2021

Spike Protein Ecd

Lab Reagents

Human IgG antibody Laboratories manufactures the spike protein ecd reagents distributed by Genprice. The Spike Protein Ecd reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Spike ECD. Other Spike products are available in stock. Specificity: Spike Category: Protein Group: Ecd

Ecd information

ECD Antibody
DF12968 200ul
EUR 304
Description: ECD Antibody detects endogenous levels of ECD.

ECD Antibody
1-CSB-PA007370GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ECD. Recognizes ECD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ECD Antibody
1-CSB-PA007370LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ECD. Recognizes ECD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

ECD siRNA
20-abx914899
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ECD siRNA
20-abx914900
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ECD
YF-PA27502 50 ug
EUR 363
Description: Mouse polyclonal to ECD

ECD Recombinant Protein (Human)
RP010117 100 ug Ask for price

ECD Recombinant Protein (Mouse)
RP130709 100 ug Ask for price

Recombinant (Sf9) Purified MERS Spike protein ECD (1-1297 a.a, His-tag, ~157 kda, low Endotoxin)
MERSS126-R-10 10 ug
EUR 347

ECD Blocking Peptide
DF12968-BP 1mg
EUR 195

ECD Conjugated Antibody
C47313 100ul
EUR 397

ECD cloning plasmid
CSB-CL007370HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1935
  • Sequence: atggaagaaaccatgaagcttgctacgatggaagacacagtggagtactgcctgttcctgataccagatgagtcaagggactcagataaacataaagagattcttcagaagtacattgagagaataatcactcggtttgcacctatgctggtcccctacatctggcagaatcagc
  • Show more
Description: A cloning plasmid for the ECD gene.

ECD Polyclonal Antibody
A58886 100 µg
EUR 570.55
Description: Ask the seller for details

anti- ECD antibody
FNab02619 100µg
EUR 548.75
  • Immunogen: ecdysoneless homolog(Drosophila)
  • Uniprot ID: O95905
  • Gene ID: 11319
  • Research Area: Metabolism
Description: Antibody raised against ECD

Anti-ECD antibody
PAab02619 100 ug
EUR 386

SARS-CoV Spike Protein
abx060655-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS Spike Antibody
24216-100ul 100ul
EUR 390