Spike Protein Ecd

Lab Reagents

Human IgG antibody Laboratories manufactures the spike protein ecd reagents distributed by Genprice. The Spike Protein Ecd reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Spike ECD. Other Spike products are available in stock. Specificity: Spike Category: Protein Group: Ecd

Ecd information

ECD Antibody
47313-100ul	SAB	100ul	EUR 252

ECD antibody
70R-16985	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ECD antibody

ECD Antibody
DF12968	Affbiotech	200ul	EUR 304
Description: ECD Antibody detects endogenous levels of ECD.

ECD Antibody
1-CSB-PA007370GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ECD. Recognizes ECD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ECD Antibody
1-CSB-PA007370LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ECD. Recognizes ECD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

anti-ECD
YF-PA27502	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to ECD

ECD Recombinant Protein (Human)
RP010117	ABM	100 ug	Ask for price

ECD Recombinant Protein (Mouse)
RP130709	ABM	100 ug	Ask for price

Recombinant (Sf9) Purified MERS Spike protein ECD (1-1297 a.a, His-tag, ~157 kda, low Endotoxin)
MERSS126-R-10	Alpha Diagnostics	10 ug	EUR 347

ECD Conjugated Antibody
C47313	SAB	100ul	EUR 397

ECD cloning plasmid
CSB-CL007370HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1935 Sequence: atggaagaaaccatgaagcttgctacgatggaagacacagtggagtactgcctgttcctgataccagatgagtcaagggactcagataaacataaagagattcttcagaagtacattgagagaataatcactcggtttgcacctatgctggtcccctacatctggcagaatcagc Show more
Description: A cloning plasmid for the ECD gene.

anti- ECD antibody
FNab02619	FN Test	100µg	EUR 548.75
Immunogen: ecdysoneless homolog(Drosophila) Uniprot ID: O95905 Gene ID: 11319 Research Area: Metabolism
Description: Antibody raised against ECD

ECD Polyclonal Antibody
A58886	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

ECD Blocking Peptide
DF12968-BP	Affbiotech	1mg	EUR 195

Anti-ECD antibody
PAab02619	Lifescience Market	100 ug	EUR 386

SARS-CoV Spike Protein
abx060655-1mg	Abbexa	1 mg	EUR 1692
Shipped within 5-10 working days.

SARS Spike Antibody
20-abx137200	Abbexa	EUR 1177.00 EUR 1887.00 EUR 2221.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.