Lab Reagents
Human IgG antibody Laboratories manufactures the spike protein ecd reagents distributed by Genprice. The Spike Protein Ecd reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Spike ECD. Other Spike products are available in stock. Specificity: Spike Category: Protein Group: Ecd
Ecd information
ECD Antibody |
47313-100ul |
SAB |
100ul |
EUR 252 |
ECD antibody |
70R-16985 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal ECD antibody |
ECD Antibody |
DF12968 |
Affbiotech |
200ul |
EUR 304 |
Description: ECD Antibody detects endogenous levels of ECD. |
ECD Antibody |
1-CSB-PA007370GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against ECD. Recognizes ECD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
ECD Antibody |
1-CSB-PA007370LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ECD. Recognizes ECD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000 |
anti-ECD |
YF-PA27502 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to ECD |
ECD Recombinant Protein (Human) |
RP010117 |
ABM |
100 ug |
Ask for price |
ECD Recombinant Protein (Mouse) |
RP130709 |
ABM |
100 ug |
Ask for price |
Recombinant (Sf9) Purified MERS Spike protein ECD (1-1297 a.a, His-tag, ~157 kda, low Endotoxin) |
MERSS126-R-10 |
Alpha Diagnostics |
10 ug |
EUR 347 |
ECD Conjugated Antibody |
C47313 |
SAB |
100ul |
EUR 397 |
ECD cloning plasmid |
CSB-CL007370HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1935
- Sequence: atggaagaaaccatgaagcttgctacgatggaagacacagtggagtactgcctgttcctgataccagatgagtcaagggactcagataaacataaagagattcttcagaagtacattgagagaataatcactcggtttgcacctatgctggtcccctacatctggcagaatcagc
- Show more
|
Description: A cloning plasmid for the ECD gene. |
anti- ECD antibody |
FNab02619 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: ecdysoneless homolog(Drosophila)
- Uniprot ID: O95905
- Gene ID: 11319
- Research Area: Metabolism
|
Description: Antibody raised against ECD |
ECD Polyclonal Antibody |
A58886 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
ECD Blocking Peptide |
DF12968-BP |
Affbiotech |
1mg |
EUR 195 |
SARS-CoV Spike Protein |
abx060655-1mg |
Abbexa |
1 mg |
EUR 1692 |
- Shipped within 5-10 working days.
|
SARS Spike Antibody |
20-abx137200 |
Abbexa |
-
EUR 1177.00
-
EUR 1887.00
-
EUR 2221.00
|
|
- Shipped within 5-10 working days.
|