September 27, 2021

Analytical validation of the droplet digital PCR assay for prognosis

Excessive-level Multiplexing in Digital PCR With Intercalating Dyes by Coupling Actual-Time Kinetics and Melting Curve Evaluation

Digital polymerase chain response (dPCR) is a mature approach that has enabled scientific breakthroughs in a number of fields. Nonetheless, this know-how is primarily utilized in analysis environments with high-level multiplexing representing a serious problem. Right here, we suggest a novel technique for multiplexing, known as amplification and melting curve evaluation (AMCA), which leverages the kinetic data in real-time amplification information and the thermodynamic melting profile utilizing an inexpensive intercalating dye (EvaGreen).


The strategy trains a system comprised of supervised machine studying fashions for correct classification, by advantage of the massive quantity of information from dPCR platforms. As a case research, we develop a brand new 9-plex assay to detect mobilised colistin resistant (mcr) genes as clinically related targets for antimicrobial resistance. Over 100,000 amplification occasions have been analysed, and for the optimistic reactions, the AMCA method experiences a classification accuracy of 99.33 ± 0.13%, a rise of 10.0% over utilizing melting curve evaluation. This work supplies an inexpensive technique of high-level multiplexing with out fluorescent probes, extending the advantages of dPCR in analysis and scientific settings.


Anti-GPR110 antibody

STJ93320 200 µl
EUR 197
Description: Rabbit polyclonal to GPR110.

anti-GPCR GPR110

YF-PA22867 50 ul
EUR 363
Description: Mouse polyclonal to GPCR GPR110

anti-GPCR GPR110

YF-PA22868 50 ug
EUR 363
Description: Mouse polyclonal to GPCR GPR110

GPR110 antibody

70R-31396 100 ug
EUR 327
Description: Rabbit polyclonal GPR110 antibody

GPR110 Antibody

44961-100ul 100ul
EUR 252

GPR110 Antibody

44961-50ul 50ul
EUR 187

GPR110 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR110. Recognizes GPR110 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/40000

GPR110 Antibody

DF2796 200ul
EUR 304
Description: GPR110 antibody detects endogenous levels of total GPR110.

GPR110 Antibody

DF4891 200ul
EUR 304
Description: GPR110 Antibody detects endogenous levels of total GPR110.

GPR110 antibody

70R-51217 100 ul
EUR 244
Description: Purified Polyclonal GPR110 antibody

GPR110 Antibody

ABD2796 100 ug
EUR 438

GPR110 Antibody

ABD4891 100 ug
EUR 438

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Polyclonal GPR110 Antibody

APR12205G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR110 . This antibody is tested and proven to work in the following applications:

GPR110 Conjugated Antibody

C44961 100ul
EUR 397

GPR110 Polyclonal Antibody

ABP51449-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890
  • Applications tips:
Description: A polyclonal antibody for detection of GPR110 from Human. This GPR110 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890

GPR110 Polyclonal Antibody

ABP51449-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890
  • Applications tips:
Description: A polyclonal antibody for detection of GPR110 from Human. This GPR110 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890

GPR110 Polyclonal Antibody

ABP51449-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890
  • Applications tips:
Description: A polyclonal antibody for detection of GPR110 from Human. This GPR110 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890

GPR110 Polyclonal Antibody

ES2448-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GPR110 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR110 Polyclonal Antibody

ES2448-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPR110 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR110 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR110 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR110 Blocking Peptide

DF2796-BP 1mg
EUR 195

GPR110 Blocking Peptide

DF4891-BP 1mg
EUR 195

GPR110 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Mouse GPR110 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPR110 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

GPR110 ORF Vector (Human) (pORF)

ORF020338 1.0 ug DNA
EUR 405

Gpr110 ORF Vector (Mouse) (pORF)

ORF046467 1.0 ug DNA
EUR 506

G Protein-Coupled Receptor 110 (GPR110) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 110 (GPR110) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 110 (GPR110) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gpr110 sgRNA CRISPR Lentivector set (Mouse)

K3842201 3 x 1.0 ug
EUR 339

GPR110 sgRNA CRISPR Lentivector set (Human)

K0894901 3 x 1.0 ug
EUR 339

Gpr110 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3842202 1.0 ug DNA
EUR 154

Gpr110 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3842203 1.0 ug DNA
EUR 154

Gpr110 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3842204 1.0 ug DNA
EUR 154

GPR110 sgRNA CRISPR Lentivector (Human) (Target 1)

K0894902 1.0 ug DNA
EUR 154

GPR110 sgRNA CRISPR Lentivector (Human) (Target 2)

K0894903 1.0 ug DNA
EUR 154

GPR110 sgRNA CRISPR Lentivector (Human) (Target 3)

K0894904 1.0 ug DNA
EUR 154

GPR110 Protein Vector (Mouse) (pPB-C-His)

PV185866 500 ng
EUR 1065

GPR110 Protein Vector (Mouse) (pPB-N-His)

PV185867 500 ng
EUR 1065

GPR110 Protein Vector (Mouse) (pPM-C-HA)

PV185868 500 ng
EUR 1065

GPR110 Protein Vector (Mouse) (pPM-C-His)

PV185869 500 ng
EUR 1065

GPR110 Protein Vector (Human) (pPB-C-His)

PV081349 500 ng
EUR 552

GPR110 Protein Vector (Human) (pPB-N-His)

PV081350 500 ng
EUR 552

GPR110 Protein Vector (Human) (pPM-C-HA)

PV081351 500 ng
EUR 552

GPR110 Protein Vector (Human) (pPM-C-His)

PV081352 500 ng
EUR 552

Gpr110 3'UTR Luciferase Stable Cell Line

TU108961 1.0 ml Ask for price

Gpr110 3'UTR GFP Stable Cell Line

TU158961 1.0 ml Ask for price

GPR110 3'UTR GFP Stable Cell Line

TU059201 1.0 ml
EUR 1521

GPR110 3'UTR Luciferase Stable Cell Line

TU009201 1.0 ml
EUR 1521

Mouse G- protein coupled receptor 110, Gpr110 ELISA KIT

ELI-09748m 96 Tests
EUR 865

Human Probable G- protein coupled receptor 110, GPR110 ELISA KIT

ELI-08749h 96 Tests
EUR 824

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3842205 3 x 1.0 ug
EUR 376

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0894905 3 x 1.0 ug
EUR 376

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3842206 1.0 ug DNA
EUR 167

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3842207 1.0 ug DNA
EUR 167

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3842208 1.0 ug DNA
EUR 167

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0894906 1.0 ug DNA
EUR 167

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0894907 1.0 ug DNA
EUR 167

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0894908 1.0 ug DNA
EUR 167

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-DDB1 Antibody

A00333 100uL
EUR 455
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies
  • Sperm Antibodies
  • Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)

ELK8071 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-CYFIP2 Antibody

A06562 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CYFIP2 Antibody (CYFIP2) detection.tested for IHC, WB in Human, Mouse, Rat.

Anti-GPS2 Antibody

A06569 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GPS2 Antibody (GPS2) detection. Tested with WB in Human, Mouse, Rat.

Anti-PRKX Antibody

A06585-1 100ul
EUR 397
Description: Rabbit Polyclonal PRKX Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-PPA2 Antibody

A06587 100ug/vial
EUR 294

Anti-GluR8 Antibody

A06589 100ul
EUR 397
Description: Rabbit Polyclonal GluR8 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-EDG7 Antibody

A06597-1 100ul
EUR 397
Description: Rabbit Polyclonal EDG7 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-KIR2.3 Antibody

A06605-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for KIR2.3 Antibody (KCNJ4) detection. Tested with WB in Human, Mouse, Rat.

Anti-GALK1 Antibody

A06627 100ul
EUR 397
Description: Rabbit Polyclonal GALK1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PRAME Antibody

A06628-2 100ug/vial
EUR 294

Anti-GP2 Antibody

A06630-1 100ug/vial
EUR 334

Anti-USP21 Antibody

A06639 100ug/200ul
EUR 397
Description: Goat Polyclonal USP21 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TLK2 Antibody

A06645 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for TLK2 Antibody (TLK2) detection. Tested with WB in Human, Mouse.

Anti-PPP1R3C Antibody

A06658 100ul
EUR 397
Description: Rabbit Polyclonal PPP1R3C Antibody. Validated in WB and tested in Human.

Anti-LRRK1 Antibody

A06670 100ul
EUR 397
Description: Rabbit Polyclonal LRRK1 Antibody. Validated in IF, IHC and tested in Human.

Anti-MNDA Antibody

A06675 100ul
EUR 397
Description: Rabbit Polyclonal MNDA Antibody. Validated in WB and tested in Human.

Anti-KAL1 Antibody

A06684 100ul
EUR 397
Description: Rabbit Polyclonal KAL1 Antibody. Validated in WB and tested in Human.

Anti-COL14A1 Antibody

A06685 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for COL14A1 Antibody (COL14A1) detection.tested for IHC in Human, Mouse, Rat.

Anti-CYP4B1 Antibody

A06690 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CYP4B1 Antibody (CYP4B1) detection.tested for WB in Human.

Anti-RFX2 Antibody

A06709 100ul
EUR 397
Description: Rabbit Polyclonal RFX2 Antibody. Validated in IHC and tested in Human.

Anti-GPR92 Antibody

A06721 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GPR92 Antibody (LPAR5) detection. Tested for WB, IHC, IF in Human.

Anti-MBTPS1 Antibody

A06735 100ul
EUR 397
Description: Rabbit Polyclonal MBTPS1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PLA2G1B Antibody

A06738 100ug/200ul
EUR 397
Description: Goat Polyclonal PLA2G1B Antibody. Validated in WB and tested in Human.

Anti-GNB5 Antibody

A06754 100ul
EUR 397
Description: Rabbit Polyclonal GNB5 Antibody. Validated in IHC, WB and tested in Human.

Anti-BAIAP2L1 Antibody

A06770 100ul
EUR 397
Description: Rabbit Polyclonal BAIAP2L1 Antibody. Validated in WB and tested in Human.

Anti-IRTKS Antibody

A06770-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for IRTKS Antibody (BAIAP2L1) detection.tested for WB in Human, Mouse, Rat.

Anti-MLF1 Antibody

A06772 100ul
EUR 397
Description: Rabbit Polyclonal MLF1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-NDR2 Antibody

A06774 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for NDR2 Antibody (STK38L) detection.tested for WB in Human, Mouse, Rat.

Anti-LARG Antibody

A06802-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for LARG Antibody (ARHGEF12) detection. Tested with WB in Human, Mouse, Rat.

Anti-GAS1 Antibody

A06815-1 100ul
EUR 397
Description: Rabbit Polyclonal GAS1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-APLF Antibody

A06828-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for APLF Antibody (APLF) detection.tested for WB in Human, Mouse.

Anti-PKCB1 Antibody

A06830 100ul
EUR 397
Description: Rabbit Polyclonal PKCB1 Antibody. Validated in WB and tested in Human.

Anti-DnaJB4 Antibody

A06835-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for DnaJB4 Antibody (DNAJB4) detection.tested for WB in Human, Mouse, Rat.

Anti-ArfGAP3 Antibody

A06839 100uL
EUR 455
Description: Rabbit Polyclonal ArfGAP3 Antibody. Validated in IP, IF, WB and tested in Human.

Anti-SCN2B Antibody

A06842 100ul
EUR 397
Description: Rabbit Polyclonal SCN2B Antibody. Validated in WB and tested in Human.

Anti-CD316 Antibody

A06844 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD316 Antibody (IGSF8) detection. Tested with WB in Human, Mouse.

Anti-AMOTL2 Antibody

A06852 100ug/vial
EUR 294

Anti-POM121 Antibody

A06856 100ul
EUR 397
Description: Rabbit Polyclonal POM121 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TBX22 Antibody

A06861 100ul
EUR 397
Description: Rabbit Polyclonal TBX22 Antibody. Validated in WB and tested in Human.

Anti-QORX Antibody

A06870 100ul
EUR 397
Description: Rabbit Polyclonal QORX Antibody. Validated in WB and tested in Human.

Anti-ADAM28 Antibody

A06873-1 100ug/vial
EUR 294

Anti-Adam28 Antibody

A06873-2 100ug/vial
EUR 334

Anti-KSR2 Antibody

A06876 100ul
EUR 397
Description: Rabbit Polyclonal KSR2 Antibody. Validated in IF, WB and tested in Human, Mouse.

Anti-Recoverin Antibody

A06882 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Recoverin Antibody (RCVRN) detection.tested for WB in Human, Mouse.

Anti-CRP1 Antibody

A06894 100ul
EUR 397
Description: Rabbit Polyclonal CRP1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-CD297 Antibody

A06913 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD297 Antibody (ART4) detection.tested for IHC in Human.

Anti-TAF12 Antibody

A06944-1 100ug/vial
EUR 334

Anti-AKR7A2 Antibody

A06949-1 100ug/vial
EUR 334

Anti-IPMK Antibody

A06955 100ul
EUR 397
Description: Rabbit Polyclonal IPMK Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-ARHGEF10 Antibody

A06958 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ARHGEF10 Antibody (ARHGEF10) detection.tested for WB in Human, Monkey.

Anti-BMP10 Antibody

A06968 100ul
EUR 397
Description: Rabbit Polyclonal BMP10 Antibody. Validated in WB and tested in Human.

Anti-SGK269 Antibody

A06989 100ul
EUR 397
Description: Rabbit Polyclonal SGK269 Antibody. Validated in WB and tested in Human, Mouse.

Anti-MAST205 Antibody

A07003 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for MAST205 Antibody (MAST2) detection.tested for WB in Human, Mouse.

Anti-TFF2 Antibody

A07013-1 100ug/vial
EUR 334

Anti-TFF2 Antibody

A07013-2 100ug/vial
EUR 334

Anti-FOXK1 Antibody

A07015 100ul
EUR 397
Description: Rabbit Polyclonal FOXK1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-CD158z Antibody

A07017 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD158z Antibody (KIR3DL3) detection.tested for IHC, WB in Human.

Anti-TSEN54 Antibody

A07022 100ul
EUR 397
Description: Rabbit Polyclonal TSEN54 Antibody. Validated in IHC, WB and tested in Human, Mouse.

Anti-SAR1B Antibody

A07030 100ul
EUR 397
Description: Rabbit Polyclonal SAR1B Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-Peropsin Antibody

A07038 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Peropsin Antibody (RRH) detection. Tested with WB in Human.

Anti-RALY Antibody

A07043 100ul
EUR 397
Description: Rabbit Polyclonal RALY Antibody. Validated in WB and tested in Human.

Anti-Raly Antibody

A07043-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Raly Antibody (RALY) detection. Tested with WB in Human, Mouse, Rat.

Anti-Osteoglycin Antibody

A07061 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Osteoglycin Antibody (OGN) detection. Tested with WB in Human, Mouse.

Anti-APC10 Antibody

A07065-1 100ug
EUR 455
Description: Rabbit Polyclonal APC10 Antibody. Validated in IP, WB and tested in Human.

Anti-RRBP1 Antibody

A07074-1 100ug/vial
EUR 334

Anti-DGKH Antibody

A07077-1 100ul
EUR 397
Description: Rabbit Polyclonal DGKH Antibody. Validated in IF, IHC and tested in Human, Mouse.

Anti-NUP93 Antibody

A07090 100ul
EUR 397
Description: Rabbit Polyclonal NUP93 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-RBM20 Antibody

A07094 100ug/200ul
EUR 397
Description: Goat Polyclonal RBM20 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-RhoH Antibody

A07101 100ul
EUR 397
Description: Rabbit Polyclonal RhoH Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-ZNF265 Antibody

A07103 100ul
EUR 397
Description: Rabbit Polyclonal ZNF265 Antibody. Validated in IF, WB and tested in Human.

Anti-ZIS Antibody

A07103-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ZIS Antibody (ZRANB2) detection.tested for WB in Human, Mouse, Rat.

Anti-BCAS3 Antibody

A07120 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for BCAS3 Antibody (BCAS3) detection. Tested with WB in Human, Mouse.

Anti-TAF3 Antibody

A07129 100ul
EUR 397
Description: Rabbit Polyclonal TAF3 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TIMP4 Antibody

A07131 100ug/vial
EUR 334

Anti-NIPA Antibody

A07135 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for NIPA Antibody (ZC3HC1) detection.tested for WB in Human, Mouse, Rat, Monkey.

Anti-ATP1AL1 Antibody

A07149 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ATP1AL1 Antibody (ATP12A) detection. Tested with WB in Human, Rat.

Anti-HoxB5 Antibody

A07156 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for HoxB5 Antibody (HOXB5) detection. Tested with WB in Human, Mouse.

Anti-ARRDC3 Antibody

A07177 100ul
EUR 397
Description: Rabbit Polyclonal ARRDC3 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-RGS5 Antibody

A07178 100ul
EUR 397
Description: Rabbit Polyclonal RGS5 Antibody. Validated in IHC, WB and tested in Human, Mouse.

Anti-MLF1 Antibody

A07180 100uL
EUR 443
Description: Rabbit Polyclonal MLF1 Antibody. Validated in IHC, WB and tested in Human.

Anti-G2A Antibody

A07182 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for G2A Antibody (GPR132) detection.tested for WB in Human, Mouse, Monkey.

Anti-NICE4 Antibody

A07183 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for NICE4 Antibody (UBAP2L) detection. Tested with WB in Human, Mouse.

Anti-USP36 Antibody

A07184 100ul
EUR 397
Description: Rabbit Polyclonal USP36 Antibody. Validated in IHC and tested in Human.

Anti-GPR1 Antibody

A07199 100ul
EUR 397
Description: Rabbit Polyclonal GPR1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

Anti-Tis7 Antibody

A07201 100 ug
EUR 397
Description: Rabbit Polyclonal Tis7 Antibody. Validated in WB and tested in Human.

Anti-APEX2 Antibody

A07203 100ug/vial
EUR 294

Anti-TRIM59 Antibody

A07207 100ul
EUR 397
Description: Rabbit Polyclonal TRIM59 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse.

Anti-GCN5 Antibody

A07210 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GCN5 Antibody (KAT2A) detection.tested for WB in Human, Mouse.

Anti-CNT2 Antibody

A07211-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CNT2 Antibody (SLC28A2) detection.tested for WB in Human, Mouse, Rat.

Anti-D54 Antibody

A07219-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for D54 Antibody (TPD52L2) detection. Tested with WB in Human, Mouse, Rat.

Anti-ST7 Antibody

A07235 100ug/vial
EUR 294

Anti-RAB3GAP2 Antibody

A07244 100ul
EUR 397
Description: Rabbit Polyclonal RAB3GAP2 Antibody. Validated in IHC, WB and tested in Human, Mouse.

Anti-RAB3GAP2 Antibody

A07244-3 100ug/vial
EUR 334

Detection of Helicobacter pylori in gastric most cancers tissue via histopathology, immunohistochemistry and real-time reverse transcription-PCR


Intention:Helicobacter pylori is often detected primarily based on hematoxylin-eosin (H-E) options, however, immunohistochemistry (IHC) and real-time PCR (RT-PCR) are extra exact in chronic-gastritis. We evaluated the relevance of those checks in Peruvian gastric most cancers samples.


Supplies & strategies: We carried out and evaluated H-E, IHC staining and RT-PCR in 288 gastric tumors. Slides have been independently evaluated by three pathologists.


Outcomes:H. pylori was detected in 167/287 via H-E, 140/288 via IHC and 175/288 via RT-PCR, and positive-status have been related (p < 0.001). H. pylori detection by H-E had an excellent concordance with IHC (kappa index = 0.632) however poor with RT-PCR (kappa index = 0.317). Greater median gene-copies have been present in excessive H. pylori density via H-E or IHC (p < 0.001).


Conclusion: H-E analysis is correct in gastric most cancers, and IHC and RT-PCR can complement its outcomes.


Analytical validation of the droplet digital PCR assay for prognosis of spinal muscular atrophy


Background: Spinal muscular atrophy (SMA) is a progressive motor neuron illness attributable to homozygote lack of exon 7 on the survival motor neuron 1 (SMN1) gene. The severity of the SMA phenotype is influenced by copies of SMN2, a gene that’s extremely homologous with SMN1.


Strategies: We validated analytical efficiency of droplet digital polymerase chain response (ddPCR) for detection of copy quantity variation of SMN1 and SMN2 genes for prognosis of SMA utilizing scientific samples. For accuracy efficiency analysis, ddPCR outcomes have been in contrast with these of multiplex ligation-dependent probe amplification (MLPA) as a reference normal. Copy numbers of SMN1/SMN2 exon 7 from 200 scientific samples have been concordant between ddPCR and MLPA.


Outcomes: For all samples, the copy variety of SMN1/SMN2 exon 7 was concordant between MLPA and ddPCR. The ddPCR additionally confirmed acceptable levels of repeatability and whole imprecision.


Conclusion: Due to this fact, ddPCR is predicted to be helpful for SMA prognosis and to foretell phenotypic severity of SMA sufferers by figuring out the copy quantity ofSMN2in scientific laboratories.


A multiplex PCR equipment for the detection of three main virulent genes in Enterococcus faecalis

A multiplex PCR equipment that detects three main virulence genes, gelE, hyl and asaI, in Enterococcus faecalis was developed. Analyses of the accessible sequences of the three main virulence genes and the designed primers allowed us to develop the three-gene, multiplex PCR protocol that maintained the specificity of every primer pair. The ensuing three amplicon bands for gelE, hyl and asaI have been even and distinct with product sizes of 213, 273 and 713 bp, respectively.


The multiplex PCR process was validated with a complete of 243 E. faecalis strains that included 02 ATCC strains, 109 isolates from marine samples (sediment, water and sea meals), 22 isolates from cattle fodder, 79 isolates contemporary water samples and 31isolates from nosocomial samples. Specificity of the equipment was indicated by amplification of solely three main virulence genes gelE, hyl and asaI, and with none nonspecific bands. Exams for the restrict of detection revealed that amplified genes from the pattern with a minimal of 104 CFU/g or CFU/mL (10 cells/response) of E. faecalis and decrease cell load samples, after a Three h enrichment in NIOT-E. faecalis enrichment medium at 37 °C, a sensitivity degree of 10 CFU/g or CFU/mL was achieved.



Anti-GPR119 antibody

STJ71609 100 µg
EUR 359

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Polyclonal Goat Anti-GPR119 Antibody

APR16300G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GPR119 . This antibody is tested and proven to work in the following applications:

GPR119 antibody

70R-31399 100 ug
EUR 327
Description: Rabbit polyclonal GPR119 antibody

GPR119 Antibody

DF4892 200ul
EUR 304
Description: GPR119 Antibody detects endogenous levels of total GPR119.

GPR119 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR119. Recognizes GPR119 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/10000

GPR119 Antibody

ABD4892 100 ug
EUR 438

Gpr119/ Rat Gpr119 ELISA Kit

ELI-08203r 96 Tests
EUR 886

GPR119 Polyclonal Antibody

40973-100ul 100ul
EUR 252

GPR119 Polyclonal Antibody

40973-50ul 50ul
EUR 187

GPR119 Polyclonal Antibody

ABP53820-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

GPR119 Polyclonal Antibody

ABP53820-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

GPR119 Polyclonal Antibody

ABP53820-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

GPR119 Polyclonal Antibody

ES4819-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GPR119 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR119 Polyclonal Antibody

ES4819-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPR119 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR119 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR119 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR119 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR119 Polyclonal Conjugated Antibody

C40973 100ul
EUR 397

GPR119 Blocking Peptide

DF4892-BP 1mg
EUR 195

GPR119 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

GPR119 cloning plasmid

CSB-CL840575HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1008
  • Sequence: atggaatcatctttctcatttggagtgatccttgctgtcctggcctccctcatcattgctactaacacactagtggctgtggctgtgctgctgttgatccacaagaatgatggtgtcagtctctgcttcaccttgaatctggctgtggctgacaccttgattggtgtggccatct
  • Show more
Description: A cloning plasmid for the GPR119 gene.

GPR119 Rabbit pAb

A18544-100ul 100 ul
EUR 308

GPR119 Rabbit pAb

A18544-200ul 200 ul
EUR 459

GPR119 Rabbit pAb

A18544-20ul 20 ul
EUR 183

GPR119 Rabbit pAb

A18544-50ul 50 ul
EUR 223

Polyclonal GPR119 Antibody (aa186-235)

APR16477G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (aa186-235). This antibody is tested and proven to work in the following applications:

Polyclonal GPR119 Antibody (Cytoplasmic Domain)

APR16478G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPR119 Antibody (Cytoplasmic Domain)

APR16479G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Mouse Gpr119 ELISA KIT

ELI-09750m 96 Tests
EUR 865

Rat GPR119 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPR119 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GPR119 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-48829h 96 Tests
EUR 824

GPR119 Recombinant Protein (Human)

RP039541 100 ug Ask for price

GPR119 Recombinant Protein (Rat)

RP203282 100 ug Ask for price

GPR119 Recombinant Protein (Mouse)

RP139418 100 ug Ask for price

G-Protein Coupled Receptor 119 (GPR119) Antibody

abx215630-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 119 (GPR119) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 119 (GPR119) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 119 (GPR119) Antibody

abx432763-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Gpr119 ORF Vector (Rat) (pORF)

ORF067762 1.0 ug DNA
EUR 506

GPR119 ORF Vector (Human) (pORF)

ORF013181 1.0 ug DNA
EUR 354

Gpr119 ORF Vector (Mouse) (pORF)

ORF046474 1.0 ug DNA
EUR 506

Gpr119 sgRNA CRISPR Lentivector set (Rat)

K7204201 3 x 1.0 ug
EUR 339

Gpr119 sgRNA CRISPR Lentivector set (Mouse)

K3605701 3 x 1.0 ug
EUR 339

GPR119 sgRNA CRISPR Lentivector set (Human)

K0895801 3 x 1.0 ug
EUR 339

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7204202 1.0 ug DNA
EUR 154

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7204203 1.0 ug DNA
EUR 154

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7204204 1.0 ug DNA
EUR 154

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3605702 1.0 ug DNA
EUR 154

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3605703 1.0 ug DNA
EUR 154

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3605704 1.0 ug DNA
EUR 154

GPR119 sgRNA CRISPR Lentivector (Human) (Target 1)

K0895802 1.0 ug DNA
EUR 154

GPR119 sgRNA CRISPR Lentivector (Human) (Target 2)

K0895803 1.0 ug DNA
EUR 154

GPR119 sgRNA CRISPR Lentivector (Human) (Target 3)

K0895804 1.0 ug DNA
EUR 154

GPR119 Protein Vector (Rat) (pPB-C-His)

PV271046 500 ng
EUR 603

GPR119 Protein Vector (Rat) (pPB-N-His)

PV271047 500 ng
EUR 603

GPR119 Protein Vector (Rat) (pPM-C-HA)

PV271048 500 ng
EUR 603

GPR119 Protein Vector (Rat) (pPM-C-His)

PV271049 500 ng
EUR 603

GPR119 Protein Vector (Mouse) (pPB-C-His)

PV185894 500 ng
EUR 603

GPR119 Protein Vector (Mouse) (pPB-N-His)

PV185895 500 ng
EUR 603

GPR119 Protein Vector (Mouse) (pPM-C-HA)

PV185896 500 ng
EUR 603

GPR119 Protein Vector (Mouse) (pPM-C-His)

PV185897 500 ng
EUR 603

GPR119 Protein Vector (Human) (pPB-C-His)

PV052721 500 ng
EUR 481

GPR119 Protein Vector (Human) (pPB-N-His)

PV052722 500 ng
EUR 481

GPR119 Protein Vector (Human) (pPM-C-HA)

PV052723 500 ng
EUR 481

GPR119 Protein Vector (Human) (pPM-C-His)

PV052724 500 ng
EUR 481

Gpr119 3'UTR Luciferase Stable Cell Line

TU108968 1.0 ml Ask for price

Gpr119 3'UTR Luciferase Stable Cell Line

TU205325 1.0 ml Ask for price

Gpr119 3'UTR GFP Stable Cell Line

TU158968 1.0 ml Ask for price

Gpr119 3'UTR GFP Stable Cell Line

TU255325 1.0 ml Ask for price

GPR119 3'UTR GFP Stable Cell Line

TU059210 1.0 ml
EUR 2333

GPR119 3'UTR Luciferase Stable Cell Line

TU009210 1.0 ml
EUR 2333

GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV629167 1.0 ug DNA
EUR 682

GPR119 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV629171 1.0 ug DNA
EUR 682

GPR119 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV629172 1.0 ug DNA
EUR 682

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7204205 3 x 1.0 ug
EUR 376

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3605705 3 x 1.0 ug
EUR 376

GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0895805 3 x 1.0 ug
EUR 376

GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV629168 1.0 ug DNA
EUR 682

GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV629169 1.0 ug DNA
EUR 740

GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV629170 1.0 ug DNA
EUR 740

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7204206 1.0 ug DNA
EUR 167

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7204207 1.0 ug DNA
EUR 167

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7204208 1.0 ug DNA
EUR 167

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3605706 1.0 ug DNA
EUR 167

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3605707 1.0 ug DNA
EUR 167

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3605708 1.0 ug DNA
EUR 167

GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0895806 1.0 ug DNA
EUR 167

GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0895807 1.0 ug DNA
EUR 167

GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0895808 1.0 ug DNA
EUR 167

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-DDB1 Antibody

A00333 100uL
EUR 455
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies
  • Sperm Antibodies
  • Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)

ELK8071 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-CYFIP2 Antibody

A06562 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CYFIP2 Antibody (CYFIP2) detection.tested for IHC, WB in Human, Mouse, Rat.

Anti-GPS2 Antibody

A06569 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GPS2 Antibody (GPS2) detection. Tested with WB in Human, Mouse, Rat.

Anti-PRKX Antibody

A06585-1 100ul
EUR 397
Description: Rabbit Polyclonal PRKX Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-PPA2 Antibody

A06587 100ug/vial
EUR 294

Anti-GluR8 Antibody

A06589 100ul
EUR 397
Description: Rabbit Polyclonal GluR8 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-EDG7 Antibody

A06597-1 100ul
EUR 397
Description: Rabbit Polyclonal EDG7 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-KIR2.3 Antibody

A06605-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for KIR2.3 Antibody (KCNJ4) detection. Tested with WB in Human, Mouse, Rat.

Anti-GALK1 Antibody

A06627 100ul
EUR 397
Description: Rabbit Polyclonal GALK1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PRAME Antibody

A06628-2 100ug/vial
EUR 294

Anti-GP2 Antibody

A06630-1 100ug/vial
EUR 334

Anti-USP21 Antibody

A06639 100ug/200ul
EUR 397
Description: Goat Polyclonal USP21 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TLK2 Antibody

A06645 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for TLK2 Antibody (TLK2) detection. Tested with WB in Human, Mouse.

Anti-PPP1R3C Antibody

A06658 100ul
EUR 397
Description: Rabbit Polyclonal PPP1R3C Antibody. Validated in WB and tested in Human.

Anti-LRRK1 Antibody

A06670 100ul
EUR 397
Description: Rabbit Polyclonal LRRK1 Antibody. Validated in IF, IHC and tested in Human.

Anti-MNDA Antibody

A06675 100ul
EUR 397
Description: Rabbit Polyclonal MNDA Antibody. Validated in WB and tested in Human.

Anti-KAL1 Antibody

A06684 100ul
EUR 397
Description: Rabbit Polyclonal KAL1 Antibody. Validated in WB and tested in Human.

Anti-COL14A1 Antibody

A06685 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for COL14A1 Antibody (COL14A1) detection.tested for IHC in Human, Mouse, Rat.

Anti-CYP4B1 Antibody

A06690 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CYP4B1 Antibody (CYP4B1) detection.tested for WB in Human.

Anti-RFX2 Antibody

A06709 100ul
EUR 397
Description: Rabbit Polyclonal RFX2 Antibody. Validated in IHC and tested in Human.

Anti-GPR92 Antibody

A06721 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GPR92 Antibody (LPAR5) detection. Tested for WB, IHC, IF in Human.

Anti-MBTPS1 Antibody

A06735 100ul
EUR 397
Description: Rabbit Polyclonal MBTPS1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PLA2G1B Antibody

A06738 100ug/200ul
EUR 397
Description: Goat Polyclonal PLA2G1B Antibody. Validated in WB and tested in Human.

Anti-GNB5 Antibody

A06754 100ul
EUR 397
Description: Rabbit Polyclonal GNB5 Antibody. Validated in IHC, WB and tested in Human.

Anti-BAIAP2L1 Antibody

A06770 100ul
EUR 397
Description: Rabbit Polyclonal BAIAP2L1 Antibody. Validated in WB and tested in Human.

Anti-IRTKS Antibody

A06770-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for IRTKS Antibody (BAIAP2L1) detection.tested for WB in Human, Mouse, Rat.

Anti-MLF1 Antibody

A06772 100ul
EUR 397
Description: Rabbit Polyclonal MLF1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-NDR2 Antibody

A06774 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for NDR2 Antibody (STK38L) detection.tested for WB in Human, Mouse, Rat.

Anti-LARG Antibody

A06802-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for LARG Antibody (ARHGEF12) detection. Tested with WB in Human, Mouse, Rat.

Anti-GAS1 Antibody

A06815-1 100ul
EUR 397
Description: Rabbit Polyclonal GAS1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-APLF Antibody

A06828-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for APLF Antibody (APLF) detection.tested for WB in Human, Mouse.

Anti-PKCB1 Antibody

A06830 100ul
EUR 397
Description: Rabbit Polyclonal PKCB1 Antibody. Validated in WB and tested in Human.

Anti-DnaJB4 Antibody

A06835-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for DnaJB4 Antibody (DNAJB4) detection.tested for WB in Human, Mouse, Rat.

Anti-ArfGAP3 Antibody

A06839 100uL
EUR 455
Description: Rabbit Polyclonal ArfGAP3 Antibody. Validated in IP, IF, WB and tested in Human.

Anti-SCN2B Antibody

A06842 100ul
EUR 397
Description: Rabbit Polyclonal SCN2B Antibody. Validated in WB and tested in Human.

Anti-CD316 Antibody

A06844 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD316 Antibody (IGSF8) detection. Tested with WB in Human, Mouse.

Anti-AMOTL2 Antibody

A06852 100ug/vial
EUR 294

Anti-POM121 Antibody

A06856 100ul
EUR 397
Description: Rabbit Polyclonal POM121 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TBX22 Antibody

A06861 100ul
EUR 397
Description: Rabbit Polyclonal TBX22 Antibody. Validated in WB and tested in Human.

Anti-QORX Antibody

A06870 100ul
EUR 397
Description: Rabbit Polyclonal QORX Antibody. Validated in WB and tested in Human.

Anti-ADAM28 Antibody

A06873-1 100ug/vial
EUR 294

Anti-Adam28 Antibody

A06873-2 100ug/vial
EUR 334

Anti-KSR2 Antibody

A06876 100ul
EUR 397
Description: Rabbit Polyclonal KSR2 Antibody. Validated in IF, WB and tested in Human, Mouse.

Anti-Recoverin Antibody

A06882 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Recoverin Antibody (RCVRN) detection.tested for WB in Human, Mouse.

Anti-CRP1 Antibody

A06894 100ul
EUR 397
Description: Rabbit Polyclonal CRP1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-CD297 Antibody

A06913 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD297 Antibody (ART4) detection.tested for IHC in Human.

Anti-TAF12 Antibody

A06944-1 100ug/vial
EUR 334

Anti-AKR7A2 Antibody

A06949-1 100ug/vial
EUR 334

Anti-IPMK Antibody

A06955 100ul
EUR 397
Description: Rabbit Polyclonal IPMK Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-ARHGEF10 Antibody

A06958 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ARHGEF10 Antibody (ARHGEF10) detection.tested for WB in Human, Monkey.

Anti-BMP10 Antibody

A06968 100ul
EUR 397
Description: Rabbit Polyclonal BMP10 Antibody. Validated in WB and tested in Human.

Anti-SGK269 Antibody

A06989 100ul
EUR 397
Description: Rabbit Polyclonal SGK269 Antibody. Validated in WB and tested in Human, Mouse.

Anti-MAST205 Antibody

A07003 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for MAST205 Antibody (MAST2) detection.tested for WB in Human, Mouse.

Anti-TFF2 Antibody

A07013-1 100ug/vial
EUR 334

Anti-TFF2 Antibody

A07013-2 100ug/vial
EUR 334

Anti-FOXK1 Antibody

A07015 100ul
EUR 397
Description: Rabbit Polyclonal FOXK1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-CD158z Antibody

A07017 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD158z Antibody (KIR3DL3) detection.tested for IHC, WB in Human.

Anti-TSEN54 Antibody

A07022 100ul
EUR 397
Description: Rabbit Polyclonal TSEN54 Antibody. Validated in IHC, WB and tested in Human, Mouse.

Anti-SAR1B Antibody

A07030 100ul
EUR 397
Description: Rabbit Polyclonal SAR1B Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-Peropsin Antibody

A07038 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Peropsin Antibody (RRH) detection. Tested with WB in Human.

Anti-RALY Antibody

A07043 100ul
EUR 397
Description: Rabbit Polyclonal RALY Antibody. Validated in WB and tested in Human.

Anti-Raly Antibody

A07043-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Raly Antibody (RALY) detection. Tested with WB in Human, Mouse, Rat.

Anti-Osteoglycin Antibody

A07061 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Osteoglycin Antibody (OGN) detection. Tested with WB in Human, Mouse.

Anti-APC10 Antibody

A07065-1 100ug
EUR 455
Description: Rabbit Polyclonal APC10 Antibody. Validated in IP, WB and tested in Human.

Anti-RRBP1 Antibody

A07074-1 100ug/vial
EUR 334

Anti-DGKH Antibody

A07077-1 100ul
EUR 397
Description: Rabbit Polyclonal DGKH Antibody. Validated in IF, IHC and tested in Human, Mouse.

Anti-NUP93 Antibody

A07090 100ul
EUR 397
Description: Rabbit Polyclonal NUP93 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-RBM20 Antibody

A07094 100ug/200ul
EUR 397
Description: Goat Polyclonal RBM20 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-RhoH Antibody

A07101 100ul
EUR 397
Description: Rabbit Polyclonal RhoH Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-ZNF265 Antibody

A07103 100ul
EUR 397
Description: Rabbit Polyclonal ZNF265 Antibody. Validated in IF, WB and tested in Human.

Anti-ZIS Antibody

A07103-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ZIS Antibody (ZRANB2) detection.tested for WB in Human, Mouse, Rat.

Anti-BCAS3 Antibody

A07120 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for BCAS3 Antibody (BCAS3) detection. Tested with WB in Human, Mouse.

Leave a Reply

Your email address will not be published. Required fields are marked *